ID: 1000091282

View in Genome Browser
Species Human (GRCh38)
Location 5:157931594-157931616
Sequence TGACCTCGGCGGCGTCAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000091275_1000091282 13 Left 1000091275 5:157931558-157931580 CCGCATTGGGGCGGTGGTGGAGA 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1000091282 5:157931594-157931616 TGACCTCGGCGGCGTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000091282 Original CRISPR TGACCTCGGCGGCGTCAGGG AGG Intergenic
No off target data available for this crispr