ID: 1000091640

View in Genome Browser
Species Human (GRCh38)
Location 5:157934681-157934703
Sequence GTTTTTAAGGAGAATTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000091635_1000091640 -3 Left 1000091635 5:157934661-157934683 CCGAAAACTCCAGGATTGGGGTT No data
Right 1000091640 5:157934681-157934703 GTTTTTAAGGAGAATTTGGTGGG No data
1000091634_1000091640 -2 Left 1000091634 5:157934660-157934682 CCCGAAAACTCCAGGATTGGGGT No data
Right 1000091640 5:157934681-157934703 GTTTTTAAGGAGAATTTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000091640 Original CRISPR GTTTTTAAGGAGAATTTGGT GGG Intergenic
No off target data available for this crispr