ID: 1000092466

View in Genome Browser
Species Human (GRCh38)
Location 5:157941657-157941679
Sequence ACAGTGCTGTGATCCATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000092466_1000092468 25 Left 1000092466 5:157941657-157941679 CCATTAATGGATCACAGCACTGT No data
Right 1000092468 5:157941705-157941727 CTGTTTTTGTTTCTTTTCTCAGG No data
1000092466_1000092467 0 Left 1000092466 5:157941657-157941679 CCATTAATGGATCACAGCACTGT No data
Right 1000092467 5:157941680-157941702 TTCTCAAAGAATGTGTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000092466 Original CRISPR ACAGTGCTGTGATCCATTAA TGG (reversed) Intergenic
No off target data available for this crispr