ID: 1000095366

View in Genome Browser
Species Human (GRCh38)
Location 5:157966806-157966828
Sequence CTGGCTGCTCAGAGGGATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000095366_1000095374 20 Left 1000095366 5:157966806-157966828 CCCAAATCCCTCTGAGCAGCCAG No data
Right 1000095374 5:157966849-157966871 AAAGGACGTATCTCCACTAAAGG No data
1000095366_1000095371 2 Left 1000095366 5:157966806-157966828 CCCAAATCCCTCTGAGCAGCCAG No data
Right 1000095371 5:157966831-157966853 GAATATGACCCTATTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000095366 Original CRISPR CTGGCTGCTCAGAGGGATTT GGG (reversed) Intergenic
No off target data available for this crispr