ID: 1000098923

View in Genome Browser
Species Human (GRCh38)
Location 5:157995557-157995579
Sequence GTCTAAGCCCAAACCGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000098923_1000098925 10 Left 1000098923 5:157995557-157995579 CCTGCTTCGGTTTGGGCTTAGAC No data
Right 1000098925 5:157995590-157995612 AATAACTTTTTCTCTTAAGCTGG No data
1000098923_1000098926 21 Left 1000098923 5:157995557-157995579 CCTGCTTCGGTTTGGGCTTAGAC No data
Right 1000098926 5:157995601-157995623 CTCTTAAGCTGGTTTCAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000098923 Original CRISPR GTCTAAGCCCAAACCGAAGC AGG (reversed) Intergenic
No off target data available for this crispr