ID: 1000098925

View in Genome Browser
Species Human (GRCh38)
Location 5:157995590-157995612
Sequence AATAACTTTTTCTCTTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000098919_1000098925 24 Left 1000098919 5:157995543-157995565 CCATCATTTAAGCTCCTGCTTCG No data
Right 1000098925 5:157995590-157995612 AATAACTTTTTCTCTTAAGCTGG No data
1000098923_1000098925 10 Left 1000098923 5:157995557-157995579 CCTGCTTCGGTTTGGGCTTAGAC No data
Right 1000098925 5:157995590-157995612 AATAACTTTTTCTCTTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000098925 Original CRISPR AATAACTTTTTCTCTTAAGC TGG Intergenic
No off target data available for this crispr