ID: 1000100804

View in Genome Browser
Species Human (GRCh38)
Location 5:158014401-158014423
Sequence CTCCCAAGGAAGCCTATTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000100802_1000100804 -4 Left 1000100802 5:158014382-158014404 CCTCTTTCTGGAGATCATTCTCC No data
Right 1000100804 5:158014401-158014423 CTCCCAAGGAAGCCTATTTCAGG No data
1000100799_1000100804 10 Left 1000100799 5:158014368-158014390 CCAGAATGCTTGACCCTCTTTCT No data
Right 1000100804 5:158014401-158014423 CTCCCAAGGAAGCCTATTTCAGG No data
1000100797_1000100804 25 Left 1000100797 5:158014353-158014375 CCTGCACTCACAAACCCAGAATG No data
Right 1000100804 5:158014401-158014423 CTCCCAAGGAAGCCTATTTCAGG No data
1000100798_1000100804 11 Left 1000100798 5:158014367-158014389 CCCAGAATGCTTGACCCTCTTTC No data
Right 1000100804 5:158014401-158014423 CTCCCAAGGAAGCCTATTTCAGG No data
1000100801_1000100804 -3 Left 1000100801 5:158014381-158014403 CCCTCTTTCTGGAGATCATTCTC No data
Right 1000100804 5:158014401-158014423 CTCCCAAGGAAGCCTATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000100804 Original CRISPR CTCCCAAGGAAGCCTATTTC AGG Intergenic
No off target data available for this crispr