ID: 1000103591

View in Genome Browser
Species Human (GRCh38)
Location 5:158037931-158037953
Sequence GGACTGTACTGCGGCCATCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2375
Summary {0: 3, 1: 944, 2: 437, 3: 128, 4: 863}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000103591_1000103596 12 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103596 5:158037966-158037988 CACAACTTCAGTGGCATCAGAGG No data
1000103591_1000103603 27 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103603 5:158037981-158038003 ATCAGAGGGAGACCGGGGAGGGG 0: 19
1: 28
2: 42
3: 103
4: 422
1000103591_1000103597 13 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103597 5:158037967-158037989 ACAACTTCAGTGGCATCAGAGGG No data
1000103591_1000103598 20 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG No data
1000103591_1000103600 22 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103600 5:158037976-158037998 GTGGCATCAGAGGGAGACCGGGG 0: 18
1: 71
2: 672
3: 538
4: 508
1000103591_1000103602 26 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG No data
1000103591_1000103595 3 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103595 5:158037957-158037979 CTCAGCTTTCACAACTTCAGTGG No data
1000103591_1000103599 21 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103599 5:158037975-158037997 AGTGGCATCAGAGGGAGACCGGG No data
1000103591_1000103601 25 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103601 5:158037979-158038001 GCATCAGAGGGAGACCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000103591 Original CRISPR GGACTGTACTGCGGCCATCT CGG (reversed) Intergenic
Too many off-targets to display for this crispr