ID: 1000103592

View in Genome Browser
Species Human (GRCh38)
Location 5:158037940-158037962
Sequence GCTGAGGCTGGACTGTACTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000103592_1000103603 18 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103603 5:158037981-158038003 ATCAGAGGGAGACCGGGGAGGGG 0: 19
1: 28
2: 42
3: 103
4: 422
1000103592_1000103604 29 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103604 5:158037992-158038014 ACCGGGGAGGGGCACAACTTTGG No data
1000103592_1000103595 -6 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103595 5:158037957-158037979 CTCAGCTTTCACAACTTCAGTGG No data
1000103592_1000103596 3 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103596 5:158037966-158037988 CACAACTTCAGTGGCATCAGAGG No data
1000103592_1000103600 13 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103600 5:158037976-158037998 GTGGCATCAGAGGGAGACCGGGG 0: 18
1: 71
2: 672
3: 538
4: 508
1000103592_1000103598 11 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG No data
1000103592_1000103602 17 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG No data
1000103592_1000103601 16 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103601 5:158037979-158038001 GCATCAGAGGGAGACCGGGGAGG No data
1000103592_1000103599 12 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103599 5:158037975-158037997 AGTGGCATCAGAGGGAGACCGGG No data
1000103592_1000103597 4 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103597 5:158037967-158037989 ACAACTTCAGTGGCATCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000103592 Original CRISPR GCTGAGGCTGGACTGTACTG CGG (reversed) Intergenic
No off target data available for this crispr