ID: 1000103593

View in Genome Browser
Species Human (GRCh38)
Location 5:158037952-158037974
Sequence GAAGTTGTGAAAGCTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000103593_1000103607 30 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103607 5:158038005-158038027 ACAACTTTGGTGTCATCAGAGGG No data
1000103593_1000103603 6 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103603 5:158037981-158038003 ATCAGAGGGAGACCGGGGAGGGG 0: 19
1: 28
2: 42
3: 103
4: 422
1000103593_1000103606 29 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103606 5:158038004-158038026 CACAACTTTGGTGTCATCAGAGG No data
1000103593_1000103598 -1 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103598 5:158037974-158037996 CAGTGGCATCAGAGGGAGACCGG No data
1000103593_1000103601 4 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103601 5:158037979-158038001 GCATCAGAGGGAGACCGGGGAGG No data
1000103593_1000103604 17 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103604 5:158037992-158038014 ACCGGGGAGGGGCACAACTTTGG No data
1000103593_1000103597 -8 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103597 5:158037967-158037989 ACAACTTCAGTGGCATCAGAGGG No data
1000103593_1000103596 -9 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103596 5:158037966-158037988 CACAACTTCAGTGGCATCAGAGG No data
1000103593_1000103602 5 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG No data
1000103593_1000103599 0 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103599 5:158037975-158037997 AGTGGCATCAGAGGGAGACCGGG No data
1000103593_1000103600 1 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103600 5:158037976-158037998 GTGGCATCAGAGGGAGACCGGGG 0: 18
1: 71
2: 672
3: 538
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000103593 Original CRISPR GAAGTTGTGAAAGCTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr