ID: 1000103602

View in Genome Browser
Species Human (GRCh38)
Location 5:158037980-158038002
Sequence CATCAGAGGGAGACCGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000103594_1000103602 1 Left 1000103594 5:158037956-158037978 CCTCAGCTTTCACAACTTCAGTG No data
Right 1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG No data
1000103593_1000103602 5 Left 1000103593 5:158037952-158037974 CCAGCCTCAGCTTTCACAACTTC No data
Right 1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG No data
1000103591_1000103602 26 Left 1000103591 5:158037931-158037953 CCGAGATGGCCGCAGTACAGTCC 0: 3
1: 944
2: 437
3: 128
4: 863
Right 1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG No data
1000103592_1000103602 17 Left 1000103592 5:158037940-158037962 CCGCAGTACAGTCCAGCCTCAGC No data
Right 1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000103602 Original CRISPR CATCAGAGGGAGACCGGGGA GGG Intergenic
No off target data available for this crispr