ID: 1000104040

View in Genome Browser
Species Human (GRCh38)
Location 5:158041801-158041823
Sequence CCACCCAAGTGCACTCCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000104040_1000104045 -4 Left 1000104040 5:158041801-158041823 CCATATGGAGTGCACTTGGGTGG No data
Right 1000104045 5:158041820-158041842 GTGGCAGGGGTGCAGTCACTTGG No data
1000104040_1000104047 -2 Left 1000104040 5:158041801-158041823 CCATATGGAGTGCACTTGGGTGG No data
Right 1000104047 5:158041822-158041844 GGCAGGGGTGCAGTCACTTGGGG No data
1000104040_1000104046 -3 Left 1000104040 5:158041801-158041823 CCATATGGAGTGCACTTGGGTGG No data
Right 1000104046 5:158041821-158041843 TGGCAGGGGTGCAGTCACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000104040 Original CRISPR CCACCCAAGTGCACTCCATA TGG (reversed) Intergenic
No off target data available for this crispr