ID: 1000105884

View in Genome Browser
Species Human (GRCh38)
Location 5:158058343-158058365
Sequence TCTCCCTTACCAATTTCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000105879_1000105884 -10 Left 1000105879 5:158058330-158058352 CCCCCTTCCTTCTTCTCCCTTAC No data
Right 1000105884 5:158058343-158058365 TCTCCCTTACCAATTTCTCCCGG No data
1000105876_1000105884 19 Left 1000105876 5:158058301-158058323 CCAGAAATCAAGCCTTTGCTCAG No data
Right 1000105884 5:158058343-158058365 TCTCCCTTACCAATTTCTCCCGG No data
1000105878_1000105884 -9 Left 1000105878 5:158058329-158058351 CCCCCCTTCCTTCTTCTCCCTTA No data
Right 1000105884 5:158058343-158058365 TCTCCCTTACCAATTTCTCCCGG No data
1000105877_1000105884 7 Left 1000105877 5:158058313-158058335 CCTTTGCTCAGCTTCTCCCCCCT No data
Right 1000105884 5:158058343-158058365 TCTCCCTTACCAATTTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000105884 Original CRISPR TCTCCCTTACCAATTTCTCC CGG Intergenic
No off target data available for this crispr