ID: 1000106323

View in Genome Browser
Species Human (GRCh38)
Location 5:158062500-158062522
Sequence AAGAATAAGTATTTGGAATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000106323_1000106328 25 Left 1000106323 5:158062500-158062522 CCAGATTCCAAATACTTATTCTT No data
Right 1000106328 5:158062548-158062570 GAAGAGACTCAGGAAATAGGTGG No data
1000106323_1000106327 22 Left 1000106323 5:158062500-158062522 CCAGATTCCAAATACTTATTCTT No data
Right 1000106327 5:158062545-158062567 TATGAAGAGACTCAGGAAATAGG No data
1000106323_1000106329 30 Left 1000106323 5:158062500-158062522 CCAGATTCCAAATACTTATTCTT No data
Right 1000106329 5:158062553-158062575 GACTCAGGAAATAGGTGGTAAGG No data
1000106323_1000106326 15 Left 1000106323 5:158062500-158062522 CCAGATTCCAAATACTTATTCTT No data
Right 1000106326 5:158062538-158062560 ACGATCTTATGAAGAGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000106323 Original CRISPR AAGAATAAGTATTTGGAATC TGG (reversed) Intergenic
No off target data available for this crispr