ID: 1000115145

View in Genome Browser
Species Human (GRCh38)
Location 5:158147011-158147033
Sequence TACCTACATTCATCTACACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000115141_1000115145 11 Left 1000115141 5:158146977-158146999 CCATCTGTTTGGGATAGTGCACC No data
Right 1000115145 5:158147011-158147033 TACCTACATTCATCTACACCGGG No data
1000115143_1000115145 -10 Left 1000115143 5:158146998-158147020 CCAAGGATTCATTTACCTACATT No data
Right 1000115145 5:158147011-158147033 TACCTACATTCATCTACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000115145 Original CRISPR TACCTACATTCATCTACACC GGG Intergenic
No off target data available for this crispr