ID: 1000115511

View in Genome Browser
Species Human (GRCh38)
Location 5:158149911-158149933
Sequence CTGTGAGGATGTGAGGATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000115507_1000115511 3 Left 1000115507 5:158149885-158149907 CCTGAGCACGTCTGCAGGAGTAC No data
Right 1000115511 5:158149911-158149933 CTGTGAGGATGTGAGGATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000115511 Original CRISPR CTGTGAGGATGTGAGGATGC AGG Intergenic
No off target data available for this crispr