ID: 1000116731

View in Genome Browser
Species Human (GRCh38)
Location 5:158160765-158160787
Sequence CACAGCAACCACATTAGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000116728_1000116731 -7 Left 1000116728 5:158160749-158160771 CCTTGTCTCCTTGTCTCACAGCA No data
Right 1000116731 5:158160765-158160787 CACAGCAACCACATTAGAGGCGG No data
1000116727_1000116731 -3 Left 1000116727 5:158160745-158160767 CCTGCCTTGTCTCCTTGTCTCAC No data
Right 1000116731 5:158160765-158160787 CACAGCAACCACATTAGAGGCGG No data
1000116726_1000116731 21 Left 1000116726 5:158160721-158160743 CCTGGCAGTGTTCTAAGCACTTC No data
Right 1000116731 5:158160765-158160787 CACAGCAACCACATTAGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000116731 Original CRISPR CACAGCAACCACATTAGAGG CGG Intergenic
No off target data available for this crispr