ID: 1000121601

View in Genome Browser
Species Human (GRCh38)
Location 5:158203273-158203295
Sequence AAGGCTCCTGCCATTGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000121593_1000121601 20 Left 1000121593 5:158203230-158203252 CCATATTTTAATACACTTGAATC No data
Right 1000121601 5:158203273-158203295 AAGGCTCCTGCCATTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000121601 Original CRISPR AAGGCTCCTGCCATTGGCCT GGG Intergenic
No off target data available for this crispr