ID: 1000121652

View in Genome Browser
Species Human (GRCh38)
Location 5:158203517-158203539
Sequence GAGATCATTCATGTAAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000121652_1000121655 7 Left 1000121652 5:158203517-158203539 CCATGTTTTACATGAATGATCTC No data
Right 1000121655 5:158203547-158203569 CCTCATGAGAACTTCTATGAAGG No data
1000121652_1000121656 11 Left 1000121652 5:158203517-158203539 CCATGTTTTACATGAATGATCTC No data
Right 1000121656 5:158203551-158203573 ATGAGAACTTCTATGAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000121652 Original CRISPR GAGATCATTCATGTAAAACA TGG (reversed) Intergenic
No off target data available for this crispr