ID: 1000130286

View in Genome Browser
Species Human (GRCh38)
Location 5:158290621-158290643
Sequence CTCCCCAAGGGGCAGTTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000130286_1000130293 -5 Left 1000130286 5:158290621-158290643 CCTGCCAACTGCCCCTTGGGGAG No data
Right 1000130293 5:158290639-158290661 GGGAGCTCAGCAGTAAGCTGGGG No data
1000130286_1000130292 -6 Left 1000130286 5:158290621-158290643 CCTGCCAACTGCCCCTTGGGGAG No data
Right 1000130292 5:158290638-158290660 GGGGAGCTCAGCAGTAAGCTGGG No data
1000130286_1000130294 12 Left 1000130286 5:158290621-158290643 CCTGCCAACTGCCCCTTGGGGAG No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data
1000130286_1000130291 -7 Left 1000130286 5:158290621-158290643 CCTGCCAACTGCCCCTTGGGGAG No data
Right 1000130291 5:158290637-158290659 TGGGGAGCTCAGCAGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000130286 Original CRISPR CTCCCCAAGGGGCAGTTGGC AGG (reversed) Intergenic
No off target data available for this crispr