ID: 1000130291

View in Genome Browser
Species Human (GRCh38)
Location 5:158290637-158290659
Sequence TGGGGAGCTCAGCAGTAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000130281_1000130291 10 Left 1000130281 5:158290604-158290626 CCAGAGAGATACCACTGCCTGCC No data
Right 1000130291 5:158290637-158290659 TGGGGAGCTCAGCAGTAAGCTGG No data
1000130282_1000130291 -1 Left 1000130282 5:158290615-158290637 CCACTGCCTGCCAACTGCCCCTT No data
Right 1000130291 5:158290637-158290659 TGGGGAGCTCAGCAGTAAGCTGG No data
1000130286_1000130291 -7 Left 1000130286 5:158290621-158290643 CCTGCCAACTGCCCCTTGGGGAG No data
Right 1000130291 5:158290637-158290659 TGGGGAGCTCAGCAGTAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000130291 Original CRISPR TGGGGAGCTCAGCAGTAAGC TGG Intergenic
No off target data available for this crispr