ID: 1000130293

View in Genome Browser
Species Human (GRCh38)
Location 5:158290639-158290661
Sequence GGGAGCTCAGCAGTAAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000130281_1000130293 12 Left 1000130281 5:158290604-158290626 CCAGAGAGATACCACTGCCTGCC No data
Right 1000130293 5:158290639-158290661 GGGAGCTCAGCAGTAAGCTGGGG No data
1000130287_1000130293 -9 Left 1000130287 5:158290625-158290647 CCAACTGCCCCTTGGGGAGCTCA No data
Right 1000130293 5:158290639-158290661 GGGAGCTCAGCAGTAAGCTGGGG No data
1000130286_1000130293 -5 Left 1000130286 5:158290621-158290643 CCTGCCAACTGCCCCTTGGGGAG No data
Right 1000130293 5:158290639-158290661 GGGAGCTCAGCAGTAAGCTGGGG No data
1000130282_1000130293 1 Left 1000130282 5:158290615-158290637 CCACTGCCTGCCAACTGCCCCTT No data
Right 1000130293 5:158290639-158290661 GGGAGCTCAGCAGTAAGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000130293 Original CRISPR GGGAGCTCAGCAGTAAGCTG GGG Intergenic
No off target data available for this crispr