ID: 1000130294

View in Genome Browser
Species Human (GRCh38)
Location 5:158290656-158290678
Sequence CTGGGGAGTTACATGACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000130286_1000130294 12 Left 1000130286 5:158290621-158290643 CCTGCCAACTGCCCCTTGGGGAG No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data
1000130281_1000130294 29 Left 1000130281 5:158290604-158290626 CCAGAGAGATACCACTGCCTGCC No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data
1000130290_1000130294 -1 Left 1000130290 5:158290634-158290656 CCTTGGGGAGCTCAGCAGTAAGC No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data
1000130288_1000130294 1 Left 1000130288 5:158290632-158290654 CCCCTTGGGGAGCTCAGCAGTAA No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data
1000130289_1000130294 0 Left 1000130289 5:158290633-158290655 CCCTTGGGGAGCTCAGCAGTAAG No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data
1000130282_1000130294 18 Left 1000130282 5:158290615-158290637 CCACTGCCTGCCAACTGCCCCTT No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data
1000130287_1000130294 8 Left 1000130287 5:158290625-158290647 CCAACTGCCCCTTGGGGAGCTCA No data
Right 1000130294 5:158290656-158290678 CTGGGGAGTTACATGACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000130294 Original CRISPR CTGGGGAGTTACATGACTCC AGG Intergenic
No off target data available for this crispr