ID: 1000131946

View in Genome Browser
Species Human (GRCh38)
Location 5:158308785-158308807
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000131940_1000131946 15 Left 1000131940 5:158308747-158308769 CCATAAAAGAGAAATTAAATTTA No data
Right 1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG No data
1000131939_1000131946 19 Left 1000131939 5:158308743-158308765 CCGGCCATAAAAGAGAAATTAAA No data
Right 1000131946 5:158308785-158308807 AGGATGCTTTGGGTTCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000131946 Original CRISPR AGGATGCTTTGGGTTCTGGT GGG Intergenic
No off target data available for this crispr