ID: 1000132813

View in Genome Browser
Species Human (GRCh38)
Location 5:158316235-158316257
Sequence TCTTACATGGAGATGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000132810_1000132813 29 Left 1000132810 5:158316183-158316205 CCAATGTGTATTAAAATCATTTG No data
Right 1000132813 5:158316235-158316257 TCTTACATGGAGATGTTGGTTGG No data
1000132809_1000132813 30 Left 1000132809 5:158316182-158316204 CCCAATGTGTATTAAAATCATTT No data
Right 1000132813 5:158316235-158316257 TCTTACATGGAGATGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000132813 Original CRISPR TCTTACATGGAGATGTTGGT TGG Intergenic
No off target data available for this crispr