ID: 1000133595

View in Genome Browser
Species Human (GRCh38)
Location 5:158322956-158322978
Sequence TTGGCTAAACCATCGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000133595 Original CRISPR TTGGCTAAACCATCGGAGGA TGG Intergenic
902122287 1:14176578-14176600 TTGGCTAAAACAGAGAAGGATGG - Intergenic
906305693 1:44717431-44717453 TTGGCAAAACCATAGGGAGAAGG - Intronic
912214855 1:107597721-107597743 TTGGCTAAAGCATTGGATAAGGG + Intronic
1074871163 10:117577238-117577260 ATGGCTAAAGCATTAGAGGAGGG + Intergenic
1077876384 11:6311528-6311550 TTGCTTAAACAATAGGAGGAGGG + Intergenic
1078856390 11:15208997-15209019 TTGCCTACATCATCGGAGGCTGG - Intronic
1094133682 12:27101577-27101599 TGGCCTAAGCCATAGGAGGATGG - Intergenic
1094183821 12:27619621-27619643 TGGCCTAAGCCATAGGAGGATGG - Intronic
1100150363 12:91729263-91729285 GTGGATAGACCATGGGAGGAAGG + Intergenic
1101523462 12:105506030-105506052 TGGGCAAAGCCATCGGAAGAGGG + Intergenic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1106911075 13:34464266-34464288 TTGGCACAACCATAGGAGGCAGG - Intergenic
1110130370 13:72001572-72001594 TTGGCTAAACCTGACGAGGAAGG - Intergenic
1129262682 15:74377456-74377478 CAGGCTTAACCATGGGAGGAGGG - Intergenic
1131787397 15:95927667-95927689 TAGGCTAAAACAACTGAGGAAGG - Intergenic
1132563853 16:611499-611521 TTGACAGAACCACCGGAGGAGGG + Intronic
1133511693 16:6464808-6464830 TTGGCTTAAACATTGCAGGAAGG - Intronic
1146757935 17:35449390-35449412 TTGGCTGGACCCTCAGAGGAGGG - Intergenic
1153085494 18:1281090-1281112 TTGGCTAAACAATAGAAGTAAGG + Intergenic
1155876983 18:31101150-31101172 TTCCCTAAATCTTCGGAGGAAGG - Intronic
1156731692 18:40201727-40201749 TTTTCTAGACCATCGGAGGATGG - Intergenic
1156821071 18:41373650-41373672 TTGGTTAAACAATAGGAAGAGGG + Intergenic
1158300763 18:56049773-56049795 TTGGCTCAGCCACCGGAAGAGGG + Intergenic
928634702 2:33232118-33232140 CTGGCTCAACCATCCTAGGAGGG + Intronic
931133953 2:59375754-59375776 TTTGCAAAACCATCTGAGGCAGG + Intergenic
931734936 2:65185434-65185456 TTGGCTAAAATATCAGAGTAAGG - Intergenic
937610580 2:123856071-123856093 TTGGCTAACCCATAGGTGGAGGG - Intergenic
942097677 2:172548816-172548838 TTGGGTAAACCAACTAAGGAGGG - Intergenic
1173585060 20:44176035-44176057 TTGCCTGAACCATGGAAGGATGG - Intronic
1175282101 20:57810873-57810895 TTGGCTCATCCATCTGAGCATGG + Intergenic
1178151826 21:29803793-29803815 TTGGATAAAGCAATGGAGGAAGG - Intronic
1180204390 21:46248555-46248577 TTGGGTAAGGCATCTGAGGAGGG + Intronic
954803298 3:53200028-53200050 ATGGCCAAACCATGGGACGAGGG + Intergenic
960845251 3:121998809-121998831 TTGGCTAAGACACCGTAGGAGGG - Intronic
964025302 3:152066281-152066303 TTGACTAAAAAATCGAAGGAGGG + Intergenic
970190644 4:13513067-13513089 TTGGCTAAAACAAAGGAAGAAGG - Intergenic
970580587 4:17470988-17471010 TGGGCTAAAGCAATGGAGGAAGG + Intronic
973927752 4:55757044-55757066 TTGGCTAAATGAAAGGAGGAGGG - Intergenic
974900862 4:67996119-67996141 TTGGCTAAATCTTGGGAGGTAGG + Intergenic
982370227 4:154626331-154626353 TCTGCAAAACCATCGGAGCAAGG - Intergenic
985786267 5:1896895-1896917 TGGGCCAAAGAATCGGAGGAGGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
1000133595 5:158322956-158322978 TTGGCTAAACCATCGGAGGATGG + Intergenic
1002644887 5:180648257-180648279 CTGGCTCAACCAGGGGAGGAGGG - Intronic
1013878004 6:114857626-114857648 ATGGCTGAAGCCTCGGAGGAGGG + Intergenic
1015036148 6:128657105-128657127 TTGGCTAATCCATAGCAGCATGG + Intergenic
1019476249 7:1245868-1245890 CTGGCTAAACCCACGGTGGAAGG + Intergenic
1022102976 7:27180138-27180160 TTGTCACAGCCATCGGAGGATGG + Intronic
1026236318 7:68529949-68529971 GTGGCTAAACTAACAGAGGAAGG + Intergenic
1026401860 7:70022142-70022164 TTGGCAAAAACATCAGAGAAAGG + Intronic
1045254177 8:100505819-100505841 TTGGTGAAATCATCCGAGGAGGG - Intergenic
1055282870 9:74694998-74695020 TTGGCTAAATCTTTGGAGAAAGG - Intergenic
1056114265 9:83426593-83426615 TTGGCTAACTCATCTGAGGTGGG - Intronic
1060385907 9:123228121-123228143 TGGCCTAAACAACCGGAGGATGG + Intronic
1192129988 X:68540757-68540779 TTGGCTCATCCATCTGAGGATGG - Intergenic
1197679524 X:129367327-129367349 CAGGGTAGACCATCGGAGGAAGG + Intergenic