ID: 1000134011

View in Genome Browser
Species Human (GRCh38)
Location 5:158326703-158326725
Sequence TCTGGACACGAACACTCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000134006_1000134011 30 Left 1000134006 5:158326650-158326672 CCGAAAGAAATGAATAGAGGTAA No data
Right 1000134011 5:158326703-158326725 TCTGGACACGAACACTCCATTGG No data
1000134008_1000134011 -4 Left 1000134008 5:158326684-158326706 CCCTGAGATGGCTGCTGCTTCTG No data
Right 1000134011 5:158326703-158326725 TCTGGACACGAACACTCCATTGG No data
1000134009_1000134011 -5 Left 1000134009 5:158326685-158326707 CCTGAGATGGCTGCTGCTTCTGG No data
Right 1000134011 5:158326703-158326725 TCTGGACACGAACACTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000134011 Original CRISPR TCTGGACACGAACACTCCAT TGG Intergenic
No off target data available for this crispr