ID: 1000140922

View in Genome Browser
Species Human (GRCh38)
Location 5:158402804-158402826
Sequence CTCTATTGGAAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000140922_1000140929 4 Left 1000140922 5:158402804-158402826 CCCTGCCCCATCTTCCAATAGAG No data
Right 1000140929 5:158402831-158402853 CTAAGTGGCCTAACTGAACTTGG No data
1000140922_1000140931 20 Left 1000140922 5:158402804-158402826 CCCTGCCCCATCTTCCAATAGAG No data
Right 1000140931 5:158402847-158402869 AACTTGGTCTCCAGTTGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000140922 Original CRISPR CTCTATTGGAAGATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr