ID: 1000141761

View in Genome Browser
Species Human (GRCh38)
Location 5:158411658-158411680
Sequence TTCCTATTCTTACAGGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000141751_1000141761 30 Left 1000141751 5:158411605-158411627 CCTTCGAATCCTCAGGTAGCATA No data
Right 1000141761 5:158411658-158411680 TTCCTATTCTTACAGGGTGCCGG No data
1000141758_1000141761 -3 Left 1000141758 5:158411638-158411660 CCGGGGGGCATAGTGTGCATTTC No data
Right 1000141761 5:158411658-158411680 TTCCTATTCTTACAGGGTGCCGG No data
1000141752_1000141761 21 Left 1000141752 5:158411614-158411636 CCTCAGGTAGCATAAGCAAGAGT No data
Right 1000141761 5:158411658-158411680 TTCCTATTCTTACAGGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000141761 Original CRISPR TTCCTATTCTTACAGGGTGC CGG Intergenic
No off target data available for this crispr