ID: 1000142312

View in Genome Browser
Species Human (GRCh38)
Location 5:158417391-158417413
Sequence CAACCAGAACAATTGACCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142312_1000142317 14 Left 1000142312 5:158417391-158417413 CCTGTGGTCAATTGTTCTGGTTG No data
Right 1000142317 5:158417428-158417450 TAATTGATTATTAACATAAGTGG No data
1000142312_1000142316 -9 Left 1000142312 5:158417391-158417413 CCTGTGGTCAATTGTTCTGGTTG No data
Right 1000142316 5:158417405-158417427 TTCTGGTTGGACATCTTGGTGGG No data
1000142312_1000142315 -10 Left 1000142312 5:158417391-158417413 CCTGTGGTCAATTGTTCTGGTTG No data
Right 1000142315 5:158417404-158417426 GTTCTGGTTGGACATCTTGGTGG No data
1000142312_1000142319 26 Left 1000142312 5:158417391-158417413 CCTGTGGTCAATTGTTCTGGTTG No data
Right 1000142319 5:158417440-158417462 AACATAAGTGGCAGTCTTTAGGG No data
1000142312_1000142318 25 Left 1000142312 5:158417391-158417413 CCTGTGGTCAATTGTTCTGGTTG No data
Right 1000142318 5:158417439-158417461 TAACATAAGTGGCAGTCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142312 Original CRISPR CAACCAGAACAATTGACCAC AGG (reversed) Intergenic
No off target data available for this crispr