ID: 1000142315

View in Genome Browser
Species Human (GRCh38)
Location 5:158417404-158417426
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142312_1000142315 -10 Left 1000142312 5:158417391-158417413 CCTGTGGTCAATTGTTCTGGTTG No data
Right 1000142315 5:158417404-158417426 GTTCTGGTTGGACATCTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142315 Original CRISPR GTTCTGGTTGGACATCTTGG TGG Intergenic
No off target data available for this crispr