ID: 1000142473

View in Genome Browser
Species Human (GRCh38)
Location 5:158418953-158418975
Sequence GATACCCTGCCCCAAAGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142473_1000142481 21 Left 1000142473 5:158418953-158418975 CCCATGCTTTGGGGCAGGGTATC No data
Right 1000142481 5:158418997-158419019 CACTGAGTAGCAGAAGGAAGAGG No data
1000142473_1000142482 22 Left 1000142473 5:158418953-158418975 CCCATGCTTTGGGGCAGGGTATC No data
Right 1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG No data
1000142473_1000142476 -6 Left 1000142473 5:158418953-158418975 CCCATGCTTTGGGGCAGGGTATC No data
Right 1000142476 5:158418970-158418992 GGTATCCAGGATGTGTTTCCTGG No data
1000142473_1000142479 15 Left 1000142473 5:158418953-158418975 CCCATGCTTTGGGGCAGGGTATC No data
Right 1000142479 5:158418991-158419013 GGCCTTCACTGAGTAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142473 Original CRISPR GATACCCTGCCCCAAAGCAT GGG (reversed) Intergenic
No off target data available for this crispr