ID: 1000142477

View in Genome Browser
Species Human (GRCh38)
Location 5:158418975-158418997
Sequence GAAGGCCAGGAAACACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142477_1000142481 -1 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142481 5:158418997-158419019 CACTGAGTAGCAGAAGGAAGAGG No data
1000142477_1000142482 0 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG No data
1000142477_1000142484 20 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142484 5:158419018-158419040 GGGTGAGATTTGGAGTGAGCTGG No data
1000142477_1000142483 10 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142483 5:158419008-158419030 AGAAGGAAGAGGGTGAGATTTGG No data
1000142477_1000142479 -7 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142479 5:158418991-158419013 GGCCTTCACTGAGTAGCAGAAGG No data
1000142477_1000142485 27 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142485 5:158419025-158419047 ATTTGGAGTGAGCTGGACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142477 Original CRISPR GAAGGCCAGGAAACACATCC TGG (reversed) Intergenic
No off target data available for this crispr