ID: 1000142478

View in Genome Browser
Species Human (GRCh38)
Location 5:158418988-158419010
Sequence TCTGCTACTCAGTGAAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142478_1000142485 14 Left 1000142478 5:158418988-158419010 CCTGGCCTTCACTGAGTAGCAGA No data
Right 1000142485 5:158419025-158419047 ATTTGGAGTGAGCTGGACTTTGG No data
1000142478_1000142483 -3 Left 1000142478 5:158418988-158419010 CCTGGCCTTCACTGAGTAGCAGA No data
Right 1000142483 5:158419008-158419030 AGAAGGAAGAGGGTGAGATTTGG No data
1000142478_1000142486 18 Left 1000142478 5:158418988-158419010 CCTGGCCTTCACTGAGTAGCAGA No data
Right 1000142486 5:158419029-158419051 GGAGTGAGCTGGACTTTGGATGG No data
1000142478_1000142484 7 Left 1000142478 5:158418988-158419010 CCTGGCCTTCACTGAGTAGCAGA No data
Right 1000142484 5:158419018-158419040 GGGTGAGATTTGGAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142478 Original CRISPR TCTGCTACTCAGTGAAGGCC AGG (reversed) Intergenic
No off target data available for this crispr