ID: 1000142479

View in Genome Browser
Species Human (GRCh38)
Location 5:158418991-158419013
Sequence GGCCTTCACTGAGTAGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142474_1000142479 14 Left 1000142474 5:158418954-158418976 CCATGCTTTGGGGCAGGGTATCC No data
Right 1000142479 5:158418991-158419013 GGCCTTCACTGAGTAGCAGAAGG No data
1000142473_1000142479 15 Left 1000142473 5:158418953-158418975 CCCATGCTTTGGGGCAGGGTATC No data
Right 1000142479 5:158418991-158419013 GGCCTTCACTGAGTAGCAGAAGG No data
1000142470_1000142479 19 Left 1000142470 5:158418949-158418971 CCACCCCATGCTTTGGGGCAGGG No data
Right 1000142479 5:158418991-158419013 GGCCTTCACTGAGTAGCAGAAGG No data
1000142472_1000142479 16 Left 1000142472 5:158418952-158418974 CCCCATGCTTTGGGGCAGGGTAT No data
Right 1000142479 5:158418991-158419013 GGCCTTCACTGAGTAGCAGAAGG No data
1000142477_1000142479 -7 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142479 5:158418991-158419013 GGCCTTCACTGAGTAGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142479 Original CRISPR GGCCTTCACTGAGTAGCAGA AGG Intergenic
No off target data available for this crispr