ID: 1000142480

View in Genome Browser
Species Human (GRCh38)
Location 5:158418993-158419015
Sequence TTCCTTCTGCTACTCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142480_1000142484 2 Left 1000142480 5:158418993-158419015 CCTTCACTGAGTAGCAGAAGGAA No data
Right 1000142484 5:158419018-158419040 GGGTGAGATTTGGAGTGAGCTGG No data
1000142480_1000142485 9 Left 1000142480 5:158418993-158419015 CCTTCACTGAGTAGCAGAAGGAA No data
Right 1000142485 5:158419025-158419047 ATTTGGAGTGAGCTGGACTTTGG No data
1000142480_1000142483 -8 Left 1000142480 5:158418993-158419015 CCTTCACTGAGTAGCAGAAGGAA No data
Right 1000142483 5:158419008-158419030 AGAAGGAAGAGGGTGAGATTTGG No data
1000142480_1000142486 13 Left 1000142480 5:158418993-158419015 CCTTCACTGAGTAGCAGAAGGAA No data
Right 1000142486 5:158419029-158419051 GGAGTGAGCTGGACTTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142480 Original CRISPR TTCCTTCTGCTACTCAGTGA AGG (reversed) Intergenic
No off target data available for this crispr