ID: 1000142482

View in Genome Browser
Species Human (GRCh38)
Location 5:158418998-158419020
Sequence ACTGAGTAGCAGAAGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142474_1000142482 21 Left 1000142474 5:158418954-158418976 CCATGCTTTGGGGCAGGGTATCC No data
Right 1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG No data
1000142477_1000142482 0 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG No data
1000142472_1000142482 23 Left 1000142472 5:158418952-158418974 CCCCATGCTTTGGGGCAGGGTAT No data
Right 1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG No data
1000142470_1000142482 26 Left 1000142470 5:158418949-158418971 CCACCCCATGCTTTGGGGCAGGG No data
Right 1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG No data
1000142473_1000142482 22 Left 1000142473 5:158418953-158418975 CCCATGCTTTGGGGCAGGGTATC No data
Right 1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142482 Original CRISPR ACTGAGTAGCAGAAGGAAGA GGG Intergenic
No off target data available for this crispr