ID: 1000142484

View in Genome Browser
Species Human (GRCh38)
Location 5:158419018-158419040
Sequence GGGTGAGATTTGGAGTGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000142478_1000142484 7 Left 1000142478 5:158418988-158419010 CCTGGCCTTCACTGAGTAGCAGA No data
Right 1000142484 5:158419018-158419040 GGGTGAGATTTGGAGTGAGCTGG No data
1000142477_1000142484 20 Left 1000142477 5:158418975-158418997 CCAGGATGTGTTTCCTGGCCTTC No data
Right 1000142484 5:158419018-158419040 GGGTGAGATTTGGAGTGAGCTGG No data
1000142480_1000142484 2 Left 1000142480 5:158418993-158419015 CCTTCACTGAGTAGCAGAAGGAA No data
Right 1000142484 5:158419018-158419040 GGGTGAGATTTGGAGTGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000142484 Original CRISPR GGGTGAGATTTGGAGTGAGC TGG Intergenic
No off target data available for this crispr