ID: 1000147866

View in Genome Browser
Species Human (GRCh38)
Location 5:158470924-158470946
Sequence CTCACTGTCCTACCTGATGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000147866_1000147874 30 Left 1000147866 5:158470924-158470946 CCCGCATCAGGTAGGACAGTGAG No data
Right 1000147874 5:158470977-158470999 GTCTCTGTCTACAAGGTGGGAGG No data
1000147866_1000147873 27 Left 1000147866 5:158470924-158470946 CCCGCATCAGGTAGGACAGTGAG No data
Right 1000147873 5:158470974-158470996 CATGTCTCTGTCTACAAGGTGGG No data
1000147866_1000147870 23 Left 1000147866 5:158470924-158470946 CCCGCATCAGGTAGGACAGTGAG No data
Right 1000147870 5:158470970-158470992 TCACCATGTCTCTGTCTACAAGG No data
1000147866_1000147872 26 Left 1000147866 5:158470924-158470946 CCCGCATCAGGTAGGACAGTGAG No data
Right 1000147872 5:158470973-158470995 CCATGTCTCTGTCTACAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000147866 Original CRISPR CTCACTGTCCTACCTGATGC GGG (reversed) Intergenic
No off target data available for this crispr