ID: 1000150212

View in Genome Browser
Species Human (GRCh38)
Location 5:158492865-158492887
Sequence CTTCACATGCAGGGTGTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000150207_1000150212 9 Left 1000150207 5:158492833-158492855 CCACTGTATATGGAGGGGAGCCT No data
Right 1000150212 5:158492865-158492887 CTTCACATGCAGGGTGTTCAGGG No data
1000150201_1000150212 26 Left 1000150201 5:158492816-158492838 CCTTGTTGCCTGGTTAGCCACTG No data
Right 1000150212 5:158492865-158492887 CTTCACATGCAGGGTGTTCAGGG No data
1000150200_1000150212 29 Left 1000150200 5:158492813-158492835 CCTCCTTGTTGCCTGGTTAGCCA No data
Right 1000150212 5:158492865-158492887 CTTCACATGCAGGGTGTTCAGGG No data
1000150203_1000150212 18 Left 1000150203 5:158492824-158492846 CCTGGTTAGCCACTGTATATGGA No data
Right 1000150212 5:158492865-158492887 CTTCACATGCAGGGTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000150212 Original CRISPR CTTCACATGCAGGGTGTTCA GGG Intergenic
No off target data available for this crispr