ID: 1000153253

View in Genome Browser
Species Human (GRCh38)
Location 5:158524463-158524485
Sequence TTTGGTTGGCAGATGATGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000153248_1000153253 17 Left 1000153248 5:158524423-158524445 CCCTTCATCTTCTTCTCCTATAT No data
Right 1000153253 5:158524463-158524485 TTTGGTTGGCAGATGATGCAAGG No data
1000153249_1000153253 16 Left 1000153249 5:158524424-158524446 CCTTCATCTTCTTCTCCTATATT No data
Right 1000153253 5:158524463-158524485 TTTGGTTGGCAGATGATGCAAGG No data
1000153247_1000153253 30 Left 1000153247 5:158524410-158524432 CCAAGGTAAATGACCCTTCATCT No data
Right 1000153253 5:158524463-158524485 TTTGGTTGGCAGATGATGCAAGG No data
1000153250_1000153253 1 Left 1000153250 5:158524439-158524461 CCTATATTTCTTCAATTCACAAA No data
Right 1000153253 5:158524463-158524485 TTTGGTTGGCAGATGATGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000153253 Original CRISPR TTTGGTTGGCAGATGATGCA AGG Intergenic
No off target data available for this crispr