ID: 1000154744

View in Genome Browser
Species Human (GRCh38)
Location 5:158539411-158539433
Sequence CAGAGCTAACAGAAGGAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000154744_1000154748 16 Left 1000154744 5:158539411-158539433 CCTCTTTCCTTCTGTTAGCTCTG No data
Right 1000154748 5:158539450-158539472 ATGGAAACATAATTTTCCATTGG No data
1000154744_1000154747 -3 Left 1000154744 5:158539411-158539433 CCTCTTTCCTTCTGTTAGCTCTG No data
Right 1000154747 5:158539431-158539453 CTGACTCAGGAAACTAATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000154744 Original CRISPR CAGAGCTAACAGAAGGAAAG AGG (reversed) Intergenic
No off target data available for this crispr