ID: 1000155046

View in Genome Browser
Species Human (GRCh38)
Location 5:158542005-158542027
Sequence GACTCGAATAGAGATGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000155046_1000155048 16 Left 1000155046 5:158542005-158542027 CCAAAAGCATCTCTATTCGAGTC No data
Right 1000155048 5:158542044-158542066 CAAGCTGTTTTGGCAGATTCAGG No data
1000155046_1000155050 21 Left 1000155046 5:158542005-158542027 CCAAAAGCATCTCTATTCGAGTC No data
Right 1000155050 5:158542049-158542071 TGTTTTGGCAGATTCAGGAAGGG No data
1000155046_1000155047 6 Left 1000155046 5:158542005-158542027 CCAAAAGCATCTCTATTCGAGTC No data
Right 1000155047 5:158542034-158542056 CTCAATGATGCAAGCTGTTTTGG No data
1000155046_1000155049 20 Left 1000155046 5:158542005-158542027 CCAAAAGCATCTCTATTCGAGTC No data
Right 1000155049 5:158542048-158542070 CTGTTTTGGCAGATTCAGGAAGG No data
1000155046_1000155051 29 Left 1000155046 5:158542005-158542027 CCAAAAGCATCTCTATTCGAGTC No data
Right 1000155051 5:158542057-158542079 CAGATTCAGGAAGGGTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000155046 Original CRISPR GACTCGAATAGAGATGCTTT TGG (reversed) Intergenic
No off target data available for this crispr