ID: 1000155049

View in Genome Browser
Species Human (GRCh38)
Location 5:158542048-158542070
Sequence CTGTTTTGGCAGATTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000155046_1000155049 20 Left 1000155046 5:158542005-158542027 CCAAAAGCATCTCTATTCGAGTC No data
Right 1000155049 5:158542048-158542070 CTGTTTTGGCAGATTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000155049 Original CRISPR CTGTTTTGGCAGATTCAGGA AGG Intergenic
No off target data available for this crispr