ID: 1000163181

View in Genome Browser
Species Human (GRCh38)
Location 5:158620924-158620946
Sequence ATGCTCTTATAGAGCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000163181_1000163187 23 Left 1000163181 5:158620924-158620946 CCTTTGAGGCTCTATAAGAGCAT No data
Right 1000163187 5:158620970-158620992 CTGCTAGTTCTACAAACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000163181 Original CRISPR ATGCTCTTATAGAGCCTCAA AGG (reversed) Intergenic
No off target data available for this crispr