ID: 1000164478

View in Genome Browser
Species Human (GRCh38)
Location 5:158634699-158634721
Sequence CACCCAGATGGCCCATGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000164478_1000164483 21 Left 1000164478 5:158634699-158634721 CCTCTCCATGGGCCATCTGGGTG No data
Right 1000164483 5:158634743-158634765 CAAAGCCCAGACTCCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000164478 Original CRISPR CACCCAGATGGCCCATGGAG AGG (reversed) Intergenic
No off target data available for this crispr