ID: 1000164483

View in Genome Browser
Species Human (GRCh38)
Location 5:158634743-158634765
Sequence CAAAGCCCAGACTCCTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000164480_1000164483 16 Left 1000164480 5:158634704-158634726 CCATGGGCCATCTGGGTGGCAAC No data
Right 1000164483 5:158634743-158634765 CAAAGCCCAGACTCCTTCAGAGG No data
1000164475_1000164483 25 Left 1000164475 5:158634695-158634717 CCTACCTCTCCATGGGCCATCTG No data
Right 1000164483 5:158634743-158634765 CAAAGCCCAGACTCCTTCAGAGG No data
1000164478_1000164483 21 Left 1000164478 5:158634699-158634721 CCTCTCCATGGGCCATCTGGGTG No data
Right 1000164483 5:158634743-158634765 CAAAGCCCAGACTCCTTCAGAGG No data
1000164482_1000164483 9 Left 1000164482 5:158634711-158634733 CCATCTGGGTGGCAACAAGTGGA No data
Right 1000164483 5:158634743-158634765 CAAAGCCCAGACTCCTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000164483 Original CRISPR CAAAGCCCAGACTCCTTCAG AGG Intergenic
No off target data available for this crispr