ID: 1000167760

View in Genome Browser
Species Human (GRCh38)
Location 5:158671757-158671779
Sequence GAGTGTTACCAAAAAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000167757_1000167760 19 Left 1000167757 5:158671715-158671737 CCAAGTACATTCCATGGAGCACT No data
Right 1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG No data
1000167759_1000167760 8 Left 1000167759 5:158671726-158671748 CCATGGAGCACTAGTTCTGGAAG No data
Right 1000167760 5:158671757-158671779 GAGTGTTACCAAAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000167760 Original CRISPR GAGTGTTACCAAAAAGAAGT TGG Intergenic
No off target data available for this crispr