ID: 1000169593

View in Genome Browser
Species Human (GRCh38)
Location 5:158689127-158689149
Sequence GTGAGCAATTCTATTTCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000169591_1000169593 -1 Left 1000169591 5:158689105-158689127 CCTTTGTTCTTATACGGGATTGG No data
Right 1000169593 5:158689127-158689149 GTGAGCAATTCTATTTCAGCAGG No data
1000169588_1000169593 10 Left 1000169588 5:158689094-158689116 CCATTGGGGATCCTTTGTTCTTA No data
Right 1000169593 5:158689127-158689149 GTGAGCAATTCTATTTCAGCAGG No data
1000169587_1000169593 20 Left 1000169587 5:158689084-158689106 CCTTCAAGTTCCATTGGGGATCC No data
Right 1000169593 5:158689127-158689149 GTGAGCAATTCTATTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000169593 Original CRISPR GTGAGCAATTCTATTTCAGC AGG Intergenic
No off target data available for this crispr