ID: 1000170505

View in Genome Browser
Species Human (GRCh38)
Location 5:158698435-158698457
Sequence CTGTGTAAATAAATGCAGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000170505_1000170507 28 Left 1000170505 5:158698435-158698457 CCAGGCTGCATTTATTTACACAG 0: 1
1: 0
2: 2
3: 20
4: 157
Right 1000170507 5:158698486-158698508 AAATAAGCTTGCACTGCTAAGGG 0: 1
1: 0
2: 0
3: 10
4: 112
1000170505_1000170506 27 Left 1000170505 5:158698435-158698457 CCAGGCTGCATTTATTTACACAG 0: 1
1: 0
2: 2
3: 20
4: 157
Right 1000170506 5:158698485-158698507 TAAATAAGCTTGCACTGCTAAGG 0: 1
1: 0
2: 0
3: 8
4: 99
1000170505_1000170508 29 Left 1000170505 5:158698435-158698457 CCAGGCTGCATTTATTTACACAG 0: 1
1: 0
2: 2
3: 20
4: 157
Right 1000170508 5:158698487-158698509 AATAAGCTTGCACTGCTAAGGGG 0: 1
1: 0
2: 1
3: 12
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000170505 Original CRISPR CTGTGTAAATAAATGCAGCC TGG (reversed) Exonic
901178159 1:7319963-7319985 CTGGGTAAATAAATTTAGCAAGG - Intronic
901194952 1:7435294-7435316 CAGTGAGAATAAAGGCAGCCTGG - Intronic
901347998 1:8564518-8564540 CTGTGTAAATAAATACAGGTTGG - Intronic
901796383 1:11681658-11681680 CCGGGTACCTAAATGCAGCCTGG + Intronic
902427054 1:16331753-16331775 ATAAATAAATAAATGCAGCCAGG + Intronic
905956448 1:42001407-42001429 CTGTGCCCATAAAGGCAGCCTGG + Intronic
907321778 1:53607025-53607047 GTGTGTAAATAAACACAGCCAGG + Intronic
907496626 1:54849635-54849657 CTGTTTAAATAAAAGTGGCCTGG - Exonic
908684978 1:66707067-66707089 GTGTGTAGATACATGCAGACAGG - Intronic
909218348 1:72921106-72921128 GTTTGTAAATTAATGAAGCCAGG - Intergenic
910993963 1:93084516-93084538 CTGTGCAAAAAAACGCAGCTGGG + Intronic
912053188 1:105558496-105558518 TTGTGTAAATGGAAGCAGCCTGG - Intergenic
913646743 1:120863357-120863379 ATGTGTAAAAATATGCAGCAAGG + Intergenic
914079904 1:144399513-144399535 ATGTGTAAAAATATGCAGCAAGG - Intergenic
914174808 1:145268048-145268070 ATGTGTAAAAATATGCAGCAAGG - Intergenic
914397190 1:147281158-147281180 GTATGAAAATACATGCAGCCAGG - Intronic
915430885 1:155865889-155865911 CTAAGGAAATAAATGTAGCCTGG - Intronic
916015206 1:160743410-160743432 CTGTGGAAAGATATGCAGCTGGG - Intronic
919382318 1:196874466-196874488 ATGGGTAGACAAATGCAGCCAGG + Intronic
920058875 1:203213875-203213897 CTGGGTTAACAAAGGCAGCCAGG + Intronic
923779961 1:237013362-237013384 GTGTGAAAATAACTCCAGCCTGG + Intergenic
1062935135 10:1379854-1379876 CTGTGGAAATAGATCCAACCAGG + Intronic
1063163563 10:3439121-3439143 CTGTGTAAATAATTGCCCCAAGG + Intergenic
1063603794 10:7505821-7505843 TTGTGAAAATAAACACAGCCTGG - Intergenic
1063701651 10:8390205-8390227 ATGTATAAATAAATGCCCCCAGG + Intergenic
1064811683 10:19207075-19207097 GTATGTGAATAAATGCAGCCAGG - Intronic
1069964025 10:72098820-72098842 TTGTGTAAATCAATGCAGGCAGG - Intronic
1070618699 10:77989542-77989564 CTGAATAAACAAATGCTGCCGGG + Intronic
1070632496 10:78096734-78096756 CAGTGTAAATAAAAACCGCCAGG + Intergenic
1074853647 10:117457846-117457868 CTGTGTTAATACATGCCCCCAGG + Intergenic
1074965206 10:118484947-118484969 CTGACTAAATAAATGCAGTGAGG + Intergenic
1077728287 11:4699593-4699615 CTCCATAAAGAAATGCAGCCTGG + Intergenic
1081390849 11:42526940-42526962 CTGAAAAAAAAAATGCAGCCAGG - Intergenic
1083552483 11:63600283-63600305 CTGTTTTAAAAAATGCAGCATGG - Intronic
1085321666 11:75578053-75578075 CTATATTAATAAATTCAGCCCGG - Intergenic
1086113637 11:83224488-83224510 CTGTGTAAAGAAATGCAGGCTGG + Intronic
1087257759 11:95975495-95975517 CTGTGTAAATATGTCCAGTCGGG + Intergenic
1098018300 12:66129678-66129700 TTTTGTAAAGAAATTCAGCCGGG - Intronic
1098823567 12:75264828-75264850 CAGAGTAAAAAAATGCAGTCAGG - Intergenic
1101673629 12:106898534-106898556 GTGTGTCAACAAATGCAGCTGGG + Intergenic
1101841986 12:108334333-108334355 CTGTGTGAATAAATGCATGTGGG - Intronic
1103741810 12:123096238-123096260 TTGCGTAAATAAATGGTGCCTGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106517512 13:30467882-30467904 CTGTGGCCATAAATGCACCCTGG - Intronic
1108891159 13:55261549-55261571 CTGTGTAAATAAATGAAGCATGG + Intergenic
1111869959 13:93819042-93819064 CAGAGAAAATGAATGCAGCCTGG + Intronic
1113732760 13:112654084-112654106 CAATGAATATAAATGCAGCCGGG + Intronic
1114008621 14:18342334-18342356 CTGTGTTAATAAGGGCATCCTGG - Intergenic
1114348852 14:21827556-21827578 ATTTGTGAATAAATGAAGCCAGG + Intergenic
1115395568 14:32904678-32904700 CTGTGTACATAAATGTGGGCAGG + Intergenic
1115592535 14:34878170-34878192 CAATGTAAATAAATGTATCCTGG + Intergenic
1115803724 14:37026909-37026931 GTCTTTAAATAAATGGAGCCTGG - Intronic
1116027951 14:39537253-39537275 CTGTGTAAAAAAAAGCAGTCTGG - Intergenic
1116250551 14:42476671-42476693 CTGTGTTAATAATTTGAGCCTGG - Intergenic
1116423031 14:44755451-44755473 ATGTTTAAATAATTGCAGACTGG + Intergenic
1116557083 14:46324584-46324606 ATGAGTCAATTAATGCAGCCAGG - Intergenic
1117162818 14:53005949-53005971 CTGAGTAAATAAATGAAGGCTGG - Intergenic
1121519063 14:94573328-94573350 GTGTGTAGAGAAATGCAGCGTGG + Intronic
1123391830 15:19882906-19882928 CTGTGTTAATAAGGGCATCCTGG - Intergenic
1124442612 15:29698246-29698268 CTGTGTACACAGATGCATCCGGG - Intergenic
1127306425 15:57710194-57710216 CTGTGAAAATAGATTCAGGCAGG + Intronic
1127699191 15:61480545-61480567 CTGTGAAAGCAAATGCAGTCGGG + Intergenic
1128005672 15:64238277-64238299 CTGTACAAAAACATGCAGCCTGG + Intronic
1128318610 15:66677341-66677363 CTTTGAAAATAAATGCAGTGGGG - Intronic
1128763931 15:70239452-70239474 CTGGTCAAATAAATGCAGGCAGG - Intergenic
1128836368 15:70812093-70812115 CTTTTTAAATAAGTGGAGCCAGG - Intergenic
1132174490 15:99699820-99699842 CATTGTAGATAAAGGCAGCCAGG + Intronic
1132321682 15:100930163-100930185 CTGTCTAAATGAATAAAGCCTGG - Intronic
1141352046 16:83306921-83306943 TTGTGGAAAGAAATGCAGACAGG + Intronic
1143755918 17:9067512-9067534 CTGTGTAAATTAATGTATCCCGG - Intronic
1145405070 17:22582786-22582808 TTGTGCATATAAATGCAGTCAGG - Intergenic
1149094991 17:52828926-52828948 ATGTGGAAAAAAATGAAGCCTGG - Intergenic
1152480275 17:80546624-80546646 ATGTGCAAATAAAAGCAGCCTGG - Intronic
1156416473 18:36897305-36897327 ATTTGTAAATAAATGTGGCCTGG + Intronic
1157113880 18:44845351-44845373 GTGTGTAAATTACTGCAGTCAGG - Intronic
1159249098 18:65850465-65850487 CTCTGTAAATACATGTAGCGAGG + Intronic
1163731520 19:18952304-18952326 GTGTTTAAATATTTGCAGCCGGG + Intergenic
1163808754 19:19417126-19417148 CTGTGGAATGAAATGCAGCTGGG + Intronic
1164046135 19:21543759-21543781 CTGTATAAAAAACTGCGGCCAGG + Intronic
1165724874 19:38105756-38105778 CTGTGGAAAAATATACAGCCAGG - Intronic
1166786967 19:45373447-45373469 TTATGTAAATAAATTAAGCCGGG - Intergenic
927388480 2:22564485-22564507 CAGATTAAGTAAATGCAGCCAGG - Intergenic
927744393 2:25603451-25603473 CTCTGTAAATGAATGCTACCTGG + Intronic
928588493 2:32788362-32788384 GTGTGTAAACTAATTCAGCCTGG - Intronic
929887666 2:45893240-45893262 CTGTGAAAATGACTGCAGTCCGG + Intronic
932020539 2:68081179-68081201 ATGTGCAGATAAATGCAGCAGGG + Intronic
933286097 2:80386146-80386168 CTTTGAAAATGGATGCAGCCTGG + Intronic
935153520 2:100461484-100461506 CTGTGTAGATAAATGCTGTTGGG + Intergenic
935482115 2:103603232-103603254 CTGGGTCAAGAAATGGAGCCAGG + Intergenic
935671792 2:105562345-105562367 CTGTGTGAATAAAGGCTCCCAGG + Intergenic
935929359 2:108106664-108106686 GTGTTTAAATAACTGCAGGCAGG + Intergenic
939818643 2:146928252-146928274 CTGTGTAATGACATGGAGCCAGG + Intergenic
943262323 2:185681995-185682017 CTGTGCAAATATATGAAGCTGGG - Intergenic
946951923 2:224885534-224885556 CTGTGAAAAACAAGGCAGCCTGG - Intronic
1169116278 20:3068166-3068188 CTCTGGAAATGAATGCAGCCTGG + Intergenic
1169762406 20:9110578-9110600 CTATGAAAATAAATGAAGCAAGG - Intronic
1170613819 20:17933892-17933914 CTGTGTGCATAGCTGCAGCCAGG + Intergenic
1174418314 20:50382613-50382635 CAATATAAATAAATGCTGCCAGG - Intergenic
1174808022 20:53621386-53621408 CTATGTAAAAATATTCAGCCAGG - Intergenic
1174917760 20:54671154-54671176 TTGTATAAACGAATGCAGCCTGG + Intergenic
1177931234 21:27286434-27286456 CTGAATAAATAAATGCATCTGGG + Intergenic
1180433126 22:15273151-15273173 CTGTGTTAATAAGGGCATCCTGG - Intergenic
1180515702 22:16141064-16141086 CTGTGTTAATAAGGGCATCCTGG - Intergenic
1183583834 22:38740753-38740775 CTGTGTCTATAAATGAATCCCGG + Intronic
1183916793 22:41127354-41127376 CTGTGTCAAAAAATGGAGTCTGG + Intronic
1184956115 22:47887462-47887484 AGGTGGAAATAAATGCAACCAGG + Intergenic
1185108696 22:48888724-48888746 CTGTGGAAACAAAGGCAGCAAGG + Intergenic
949583624 3:5415005-5415027 CTGATTAAAAAAATGCAGACTGG + Intergenic
950215094 3:11153673-11153695 CTCTGGAAATGAAGGCAGCCAGG + Intronic
951822302 3:26826799-26826821 ATGGCCAAATAAATGCAGCCAGG + Intergenic
956201658 3:66712559-66712581 CTGTGTAAAAATGTGGAGCCAGG + Intergenic
956612619 3:71139762-71139784 CTGTTTCAGTAAATGCAGACTGG - Intronic
957787139 3:84897645-84897667 CTGTGAAAATAACTGCAGTTTGG + Intergenic
958505967 3:94977498-94977520 GTGTGGAAATAAATACAGACAGG + Intergenic
961205611 3:125079045-125079067 CTGGGTAAGTAAAGGAAGCCAGG - Intergenic
963635375 3:147788229-147788251 CTGTTTAAAGAAATGCTGCTTGG + Intergenic
966026885 3:175295061-175295083 ATGTGTCAATACATGCAGTCAGG + Intronic
967117981 3:186359379-186359401 CAGTGTAATAATATGCAGCCAGG + Intronic
974456101 4:62130872-62130894 CTGTGTATATACAAGCAGCTGGG + Intergenic
975414961 4:74095324-74095346 ATAAGTAAATAAATGCAGCCGGG - Intergenic
978065290 4:104391774-104391796 CCTTGTAAACAAATGCACCCAGG + Intergenic
978230587 4:106392752-106392774 AAGTGTAATTAAATGCAGCATGG - Intergenic
981466752 4:145080973-145080995 CTATGTCAATAAATTCAGCCAGG + Intronic
984235954 4:177159395-177159417 ATGGTTGAATAAATGCAGCCAGG + Intergenic
984375133 4:178920843-178920865 CTATGAAAATAAAAGCAGACAGG - Intergenic
985206573 4:187544060-187544082 GAATGTAAAAAAATGCAGCCAGG - Intergenic
985657806 5:1141026-1141048 CTGTGGAAATGAGTGCAGCCAGG + Intergenic
985895249 5:2746273-2746295 TTTTGTAAATAAATTCTGCCTGG - Exonic
986399504 5:7367027-7367049 CTGAGTAAATAAAACCAGACAGG + Intergenic
986427685 5:7650983-7651005 CTGTGGAGAGGAATGCAGCCTGG + Intronic
988318556 5:29662742-29662764 CTGTGTAAATAAATTCTGACAGG + Intergenic
990894238 5:60680873-60680895 TTGTGAAAATAGAGGCAGCCTGG + Intronic
996436189 5:123435150-123435172 GTTTGTTAATAAATGCTGCCTGG - Intergenic
996708385 5:126520101-126520123 CTGTCTAAATGAATGCTGCTGGG - Intergenic
997661942 5:135595857-135595879 GTGTGTGAATAGATGCAACCTGG - Intergenic
998744224 5:145238484-145238506 ATGTGTAAATAAATGCATTTAGG - Intergenic
998769121 5:145521680-145521702 CTATGGCAAGAAATGCAGCCTGG + Intronic
1000170505 5:158698435-158698457 CTGTGTAAATAAATGCAGCCTGG - Exonic
1000187932 5:158878951-158878973 CTGTGTAAACAAATTTAGGCTGG - Intronic
1002326684 5:178414469-178414491 ATGTGTAAAAAAAGGCAACCAGG + Intronic
1006488533 6:34365744-34365766 CTCTGAAAATAAATACAGGCCGG + Intronic
1007283649 6:40731210-40731232 CTGTGCGAATAACAGCAGCCAGG - Intergenic
1008292473 6:49734128-49734150 ATGTGTAAATAAATGAATCCAGG - Intronic
1011667557 6:89649357-89649379 ATGTGTTAATAAATGGAGCTGGG + Intronic
1016736410 6:147484903-147484925 CTGGACAAAGAAATGCAGCCAGG + Intergenic
1017808045 6:157963373-157963395 CTGTCTAAATAAATCCACGCAGG + Intergenic
1019265266 7:112294-112316 CTGTTTCAATAAATGGTGCCAGG - Intergenic
1020211709 7:6162968-6162990 CCATGAAAATAAATGCTGCCTGG - Exonic
1023591476 7:41784962-41784984 CTCTGTAAATAAATGAAGGCAGG - Intergenic
1024352840 7:48384686-48384708 CTGAGAAAATTAATGCAGGCAGG - Intronic
1024580966 7:50800417-50800439 CTTCCTAAATAAATGCAGCCTGG + Intergenic
1024685902 7:51744846-51744868 CTGTGTATACAAAGGCAGTCTGG + Intergenic
1027488776 7:78795896-78795918 CTGTTTAAATAAATGGTGCCAGG + Intronic
1028846790 7:95490486-95490508 CTGTGTAAATACATGGACACAGG + Intronic
1029889930 7:103917408-103917430 ATGTGTAAATGAATGCAGAAAGG - Intronic
1031262699 7:119542088-119542110 CTGTGAATATGAATGCAACCTGG - Intergenic
1031748035 7:125530125-125530147 CTATGTAAATAAATGTAGAGTGG - Intergenic
1033328549 7:140398843-140398865 GTGTCTAATTAAATGCAGGCCGG + Intronic
1035426765 7:158783371-158783393 CTGTGGAGCTCAATGCAGCCAGG - Intronic
1037322646 8:17658512-17658534 ATGTGTAAATACAGGCAGACAGG + Intronic
1039480626 8:37870684-37870706 CTGTGGAAACAAAAGCAGTCAGG + Intronic
1041437242 8:57855725-57855747 CTATGTAAATAAACCAAGCCTGG + Intergenic
1042591808 8:70403792-70403814 CCGTGTTAATAACTGCTGCCTGG + Exonic
1044006471 8:86943084-86943106 CTTTTTAAATAAATGCAGGCTGG + Intronic
1047597938 8:126397212-126397234 CTGAATAGATGAATGCAGCCAGG + Intergenic
1047662350 8:127051285-127051307 CTGCATAAATAAATGTAACCTGG + Intergenic
1047930706 8:129726002-129726024 CTCTTTAAATAAATTCAGCCAGG - Intergenic
1050039207 9:1471096-1471118 CTGTGTATATAAATGGAGCTGGG + Intergenic
1052031929 9:23638697-23638719 CTGTTTAAATAAAAGCAACTAGG + Intergenic
1054967096 9:71041711-71041733 CTGGGAAAATAAAGGCTGCCTGG - Intronic
1059885964 9:118745032-118745054 CTGTGCAATCATATGCAGCCTGG + Intergenic
1059986551 9:119825618-119825640 CTCTATAAATAAAAGAAGCCTGG - Intergenic
1061856656 9:133445302-133445324 CTGTGCAGAGAAATGCTGCCAGG + Intronic
1188359413 X:29234064-29234086 CTCCATAAATAAATGCAGCGTGG + Intronic
1190243898 X:48677890-48677912 CTAAGTAAATAATTGCAGTCTGG - Intronic
1190308898 X:49102610-49102632 CTAAGTAAATAATTGCAGTCTGG - Intergenic
1196223640 X:113139973-113139995 TTGTATTAATATATGCAGCCCGG - Intergenic
1197840599 X:130741995-130742017 CTTTTGAAATAAATGAAGCCTGG + Intronic
1198016887 X:132620515-132620537 CTAGGTAAATAAATGCTTCCAGG + Intergenic
1199343755 X:146714014-146714036 CTGTGAAAATAAATGTAACACGG - Intergenic